p2a egfp sequence Search Results


92
Addgene inc crop seq
Crop Seq, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/crop seq/product/Addgene inc
Average 92 stars, based on 1 article reviews
crop seq - by Bioz Stars, 2026-04
92/100 stars
  Buy from Supplier

90
Addgene inc dcas9-8xsuntag-p2a-egfp
a Schematic diagram of <t>SIMBA,</t> with its <t>components</t> including <t>dCas9-24xSunTag,</t> scFv-FKBP, and <t>FRB-mCherry-HP1α.</t> Upon rapamycin addition, HP1α can be recruited to target genomic loci and forms puncta. b Representative time-lapse images showing puncta targeted at telomeres formed upon 100 nM rapamycin addition. Scale bar, 10 μm. c Quantified signal-to-noise ratio (SNR) (Left), the numbers of labeled puncta per cell detected at different time points (Middle), and the size change in time upon the rapamycin treatment (Right) ( n = 5, 7, 8, 9, 12 nuclei). SNR number was listed in Supplementary Data . Error bars, mean ± SEM. d Representative images showing puncta formed at the Telomeres or MUC4 locus after 100 nM rapamycin treatment for 2 hrs in HEK293T cells. No sgRNA or scFv-FKBP groups serve as the negative control. Scale bar, 10 μm. e Schematic diagram showing double labeling of telomeres by using BiFC and SIMBA. f Images of telomere loci labeling with both BiFC and SIMBA in HEK293T cells upon rapamycin treatment. No dCas9 and sgRNA groups serve as the negative controls. The images were from a single slice, with possibly a slight shift in the z-plane for the images. Scale bar, 10 μm. g Normalized intensity curves from SIMBA (red) and BiFC (green) at a highlighted locus in ( f ). h The percentage of labeled telomere loci with co-localized SIMBA (red) and BiFC (green). Error bars, mean ± SEM. n = 4 biologically independent experiments for all three groups. Source data are provided as a Source Data file.
Dcas9 8xsuntag P2a Egfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dcas9-8xsuntag-p2a-egfp/product/Addgene inc
Average 90 stars, based on 1 article reviews
dcas9-8xsuntag-p2a-egfp - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

93
Addgene inc pcag cbe4max spryp2a egfp
a Schematic diagram of <t>SIMBA,</t> with its <t>components</t> including <t>dCas9-24xSunTag,</t> scFv-FKBP, and <t>FRB-mCherry-HP1α.</t> Upon rapamycin addition, HP1α can be recruited to target genomic loci and forms puncta. b Representative time-lapse images showing puncta targeted at telomeres formed upon 100 nM rapamycin addition. Scale bar, 10 μm. c Quantified signal-to-noise ratio (SNR) (Left), the numbers of labeled puncta per cell detected at different time points (Middle), and the size change in time upon the rapamycin treatment (Right) ( n = 5, 7, 8, 9, 12 nuclei). SNR number was listed in Supplementary Data . Error bars, mean ± SEM. d Representative images showing puncta formed at the Telomeres or MUC4 locus after 100 nM rapamycin treatment for 2 hrs in HEK293T cells. No sgRNA or scFv-FKBP groups serve as the negative control. Scale bar, 10 μm. e Schematic diagram showing double labeling of telomeres by using BiFC and SIMBA. f Images of telomere loci labeling with both BiFC and SIMBA in HEK293T cells upon rapamycin treatment. No dCas9 and sgRNA groups serve as the negative controls. The images were from a single slice, with possibly a slight shift in the z-plane for the images. Scale bar, 10 μm. g Normalized intensity curves from SIMBA (red) and BiFC (green) at a highlighted locus in ( f ). h The percentage of labeled telomere loci with co-localized SIMBA (red) and BiFC (green). Error bars, mean ± SEM. n = 4 biologically independent experiments for all three groups. Source data are provided as a Source Data file.
Pcag Cbe4max Spryp2a Egfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcag cbe4max spryp2a egfp/product/Addgene inc
Average 93 stars, based on 1 article reviews
pcag cbe4max spryp2a egfp - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

93
Addgene inc plasmid plv ef1a rpl22 3xha p2a egfp t2a puro
a Schematic diagram of <t>SIMBA,</t> with its <t>components</t> including <t>dCas9-24xSunTag,</t> scFv-FKBP, and <t>FRB-mCherry-HP1α.</t> Upon rapamycin addition, HP1α can be recruited to target genomic loci and forms puncta. b Representative time-lapse images showing puncta targeted at telomeres formed upon 100 nM rapamycin addition. Scale bar, 10 μm. c Quantified signal-to-noise ratio (SNR) (Left), the numbers of labeled puncta per cell detected at different time points (Middle), and the size change in time upon the rapamycin treatment (Right) ( n = 5, 7, 8, 9, 12 nuclei). SNR number was listed in Supplementary Data . Error bars, mean ± SEM. d Representative images showing puncta formed at the Telomeres or MUC4 locus after 100 nM rapamycin treatment for 2 hrs in HEK293T cells. No sgRNA or scFv-FKBP groups serve as the negative control. Scale bar, 10 μm. e Schematic diagram showing double labeling of telomeres by using BiFC and SIMBA. f Images of telomere loci labeling with both BiFC and SIMBA in HEK293T cells upon rapamycin treatment. No dCas9 and sgRNA groups serve as the negative controls. The images were from a single slice, with possibly a slight shift in the z-plane for the images. Scale bar, 10 μm. g Normalized intensity curves from SIMBA (red) and BiFC (green) at a highlighted locus in ( f ). h The percentage of labeled telomere loci with co-localized SIMBA (red) and BiFC (green). Error bars, mean ± SEM. n = 4 biologically independent experiments for all three groups. Source data are provided as a Source Data file.
Plasmid Plv Ef1a Rpl22 3xha P2a Egfp T2a Puro, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plasmid plv ef1a rpl22 3xha p2a egfp t2a puro/product/Addgene inc
Average 93 stars, based on 1 article reviews
plasmid plv ef1a rpl22 3xha p2a egfp t2a puro - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

90
Addgene inc cas13d coding sequence
( A ) Schematic of the one-vector CRISPR/Cas13b/d system construct (top) and the EGFP reporter construct (bottom). ( B ) Schematic of type VI-d (left) and VI-b (right) crRNA structures with the target RNA. The crRNAs carry a direct repeat sequence (blue) to facilitate the binding with their corresponding Cas13 enzyme, and a spacer sequence (red) specific for the target RNA, r(GGGGCC) n (purple). ( C and D ) The knockdown efficiency test in HEK293 cells via cotransfection of the <t>CRISPR/Cas13d</t> vector ( C ), or the CRISPR/Cas13b vector ( D ), and the reporter construct. Immunoblotting of EGFP showed the knockdown efficiency for different guide RNAs (gRNAs). Data are presented as means ± SD of 3 independent experiments and were analyzed with ordinary 1-way ANOVA with Dunnett’s multiple-comparison test. * P < 0.05, ** P < 0.01, *** P < 0.001.
Cas13d Coding Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cas13d coding sequence/product/Addgene inc
Average 90 stars, based on 1 article reviews
cas13d coding sequence - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

93
Addgene inc pcmv t7 abemax 7 10
( A ) Schematic of the one-vector CRISPR/Cas13b/d system construct (top) and the EGFP reporter construct (bottom). ( B ) Schematic of type VI-d (left) and VI-b (right) crRNA structures with the target RNA. The crRNAs carry a direct repeat sequence (blue) to facilitate the binding with their corresponding Cas13 enzyme, and a spacer sequence (red) specific for the target RNA, r(GGGGCC) n (purple). ( C and D ) The knockdown efficiency test in HEK293 cells via cotransfection of the <t>CRISPR/Cas13d</t> vector ( C ), or the CRISPR/Cas13b vector ( D ), and the reporter construct. Immunoblotting of EGFP showed the knockdown efficiency for different guide RNAs (gRNAs). Data are presented as means ± SD of 3 independent experiments and were analyzed with ordinary 1-way ANOVA with Dunnett’s multiple-comparison test. * P < 0.05, ** P < 0.01, *** P < 0.001.
Pcmv T7 Abemax 7 10, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcmv t7 abemax 7 10/product/Addgene inc
Average 93 stars, based on 1 article reviews
pcmv t7 abemax 7 10 - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

93
Addgene inc grna screens

Grna Screens, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/grna screens/product/Addgene inc
Average 93 stars, based on 1 article reviews
grna screens - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

93
Addgene inc p2a egfp sequence

P2a Egfp Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/p2a egfp sequence/product/Addgene inc
Average 93 stars, based on 1 article reviews
p2a egfp sequence - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

98
Addgene inc lentiguide puro p2a egfp addgene

Lentiguide Puro P2a Egfp Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lentiguide puro p2a egfp addgene/product/Addgene inc
Average 98 stars, based on 1 article reviews
lentiguide puro p2a egfp addgene - by Bioz Stars, 2026-04
98/100 stars
  Buy from Supplier

94
Addgene inc pubmed 20107439 tet o fuw egfp p2a mcherry

Pubmed 20107439 Tet O Fuw Egfp P2a Mcherry, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pubmed 20107439 tet o fuw egfp p2a mcherry/product/Addgene inc
Average 94 stars, based on 1 article reviews
pubmed 20107439 tet o fuw egfp p2a mcherry - by Bioz Stars, 2026-04
94/100 stars
  Buy from Supplier

96
Addgene inc pcag hnanog p2a egfp

Pcag Hnanog P2a Egfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcag hnanog p2a egfp/product/Addgene inc
Average 96 stars, based on 1 article reviews
pcag hnanog p2a egfp - by Bioz Stars, 2026-04
96/100 stars
  Buy from Supplier

93
Addgene inc ascas12a crrna expression vector prg212
A. Experimental workflow for double-gene deletion <t>AsCas12a</t> CRISPR screening. B. Scatter plot of median Log2 fold-change of crRNAs associated with the indicated target gene after Cas12a-mediated co-deletion of Rosa26 control (WT) or Ripk1 (Ripk1null). Fold-change is calculated between in vitro and in vivo timepoints. Targets preferentially depleted in WT (red), Ripk1null (beige), or both (blue), or targets preferentially enriched in Ripk1null (orange) are highlighted and have a P-value < 0.05 (see Methods). Also shown are Log2 fold-change for individual crRNAs (red bars) for significant hits overlaid on the distribution for all crRNAs. C. Select targets identified in (B) projected onto a schematic of the TNF signaling pathway in Ripk1 WT (top) and Ripk1null (bottom) cancer cells. Highlighted gene targets (non-opaque) are depleted in WT or enriched in Ripk1null tumors and illustrate inferred signaling bias for each genotype. D-E. Expression and quantitation of NF-kB and MAPK pathway proteins (n=2–3) (D) and NF-kB transcriptional reporter activity (representative of 3 independent experiments) (E) in WT or Ripk1null B16 cancer cells after treatment with 100 ng/ml murine TNF. F. CASP3 cleavage after TNF stimulation of TSA WT or Ripk1null cells for the indicated times under serum-free conditions. G. In vitro dose response of TNF-mediated killing with 1 ug/ml cycloheximide for 24 hours for WT or Ripk1null B16 and TSA cells measured by normalized viability (representative of 2–3 independent experiments). P-values for time course was determined by repeated measures ANOVA. For dose response and reporter assay, a non-linear model was fitted and significance determined by comparison to a reduced model using ANOVA.
Ascas12a Crrna Expression Vector Prg212, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ascas12a crrna expression vector prg212/product/Addgene inc
Average 93 stars, based on 1 article reviews
ascas12a crrna expression vector prg212 - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

Image Search Results


a Schematic diagram of SIMBA, with its components including dCas9-24xSunTag, scFv-FKBP, and FRB-mCherry-HP1α. Upon rapamycin addition, HP1α can be recruited to target genomic loci and forms puncta. b Representative time-lapse images showing puncta targeted at telomeres formed upon 100 nM rapamycin addition. Scale bar, 10 μm. c Quantified signal-to-noise ratio (SNR) (Left), the numbers of labeled puncta per cell detected at different time points (Middle), and the size change in time upon the rapamycin treatment (Right) ( n = 5, 7, 8, 9, 12 nuclei). SNR number was listed in Supplementary Data . Error bars, mean ± SEM. d Representative images showing puncta formed at the Telomeres or MUC4 locus after 100 nM rapamycin treatment for 2 hrs in HEK293T cells. No sgRNA or scFv-FKBP groups serve as the negative control. Scale bar, 10 μm. e Schematic diagram showing double labeling of telomeres by using BiFC and SIMBA. f Images of telomere loci labeling with both BiFC and SIMBA in HEK293T cells upon rapamycin treatment. No dCas9 and sgRNA groups serve as the negative controls. The images were from a single slice, with possibly a slight shift in the z-plane for the images. Scale bar, 10 μm. g Normalized intensity curves from SIMBA (red) and BiFC (green) at a highlighted locus in ( f ). h The percentage of labeled telomere loci with co-localized SIMBA (red) and BiFC (green). Error bars, mean ± SEM. n = 4 biologically independent experiments for all three groups. Source data are provided as a Source Data file.

Journal: Nature Communications

Article Title: Engineering inducible biomolecular assemblies for genome imaging and manipulation in living cells

doi: 10.1038/s41467-022-35504-x

Figure Lengend Snippet: a Schematic diagram of SIMBA, with its components including dCas9-24xSunTag, scFv-FKBP, and FRB-mCherry-HP1α. Upon rapamycin addition, HP1α can be recruited to target genomic loci and forms puncta. b Representative time-lapse images showing puncta targeted at telomeres formed upon 100 nM rapamycin addition. Scale bar, 10 μm. c Quantified signal-to-noise ratio (SNR) (Left), the numbers of labeled puncta per cell detected at different time points (Middle), and the size change in time upon the rapamycin treatment (Right) ( n = 5, 7, 8, 9, 12 nuclei). SNR number was listed in Supplementary Data . Error bars, mean ± SEM. d Representative images showing puncta formed at the Telomeres or MUC4 locus after 100 nM rapamycin treatment for 2 hrs in HEK293T cells. No sgRNA or scFv-FKBP groups serve as the negative control. Scale bar, 10 μm. e Schematic diagram showing double labeling of telomeres by using BiFC and SIMBA. f Images of telomere loci labeling with both BiFC and SIMBA in HEK293T cells upon rapamycin treatment. No dCas9 and sgRNA groups serve as the negative controls. The images were from a single slice, with possibly a slight shift in the z-plane for the images. Scale bar, 10 μm. g Normalized intensity curves from SIMBA (red) and BiFC (green) at a highlighted locus in ( f ). h The percentage of labeled telomere loci with co-localized SIMBA (red) and BiFC (green). Error bars, mean ± SEM. n = 4 biologically independent experiments for all three groups. Source data are provided as a Source Data file.

Article Snippet: Coding sequences of SIMBA components (dCas9-8xSunTag-P2A-eGFP, scFv-FKBP-T2A-FRB-mCherry-HP1α, sgRNA) were sub-cloned into a pHR lentiviral vector (Addgene #79125) to generate the corresponding lentiviral constructs.

Techniques: Labeling, Negative Control

( A ) Schematic of the one-vector CRISPR/Cas13b/d system construct (top) and the EGFP reporter construct (bottom). ( B ) Schematic of type VI-d (left) and VI-b (right) crRNA structures with the target RNA. The crRNAs carry a direct repeat sequence (blue) to facilitate the binding with their corresponding Cas13 enzyme, and a spacer sequence (red) specific for the target RNA, r(GGGGCC) n (purple). ( C and D ) The knockdown efficiency test in HEK293 cells via cotransfection of the CRISPR/Cas13d vector ( C ), or the CRISPR/Cas13b vector ( D ), and the reporter construct. Immunoblotting of EGFP showed the knockdown efficiency for different guide RNAs (gRNAs). Data are presented as means ± SD of 3 independent experiments and were analyzed with ordinary 1-way ANOVA with Dunnett’s multiple-comparison test. * P < 0.05, ** P < 0.01, *** P < 0.001.

Journal: The Journal of Clinical Investigation

Article Title: CRISPR/Cas13d targeting suppresses repeat-associated non-AUG translation of C9orf72 hexanucleotide repeat RNA

doi: 10.1172/JCI179016

Figure Lengend Snippet: ( A ) Schematic of the one-vector CRISPR/Cas13b/d system construct (top) and the EGFP reporter construct (bottom). ( B ) Schematic of type VI-d (left) and VI-b (right) crRNA structures with the target RNA. The crRNAs carry a direct repeat sequence (blue) to facilitate the binding with their corresponding Cas13 enzyme, and a spacer sequence (red) specific for the target RNA, r(GGGGCC) n (purple). ( C and D ) The knockdown efficiency test in HEK293 cells via cotransfection of the CRISPR/Cas13d vector ( C ), or the CRISPR/Cas13b vector ( D ), and the reporter construct. Immunoblotting of EGFP showed the knockdown efficiency for different guide RNAs (gRNAs). Data are presented as means ± SD of 3 independent experiments and were analyzed with ordinary 1-way ANOVA with Dunnett’s multiple-comparison test. * P < 0.05, ** P < 0.01, *** P < 0.001.

Article Snippet: Cas13d coding sequence was amplified from a plasmid (Addgene, 109049) using a forward primer introducing an NdeI site (TACCACATATGATCGAAAAAAAAAAGTCCTTCGCCAA) and a reverse primer introducing a BamHI site (TTGCAGGATCCTTAGGAATTGCCGGACACCTTCTTTTTCTC).

Techniques: Plasmid Preparation, CRISPR, Construct, Sequencing, Binding Assay, Knockdown, Cotransfection, Western Blot, Comparison

( A ) Schematic of the inducible luciferase-based C9orf72 RAN translation reporter system in HeLa Flp-In cells. ( B ) The reporter cells stably expressing Cas13d and gRNA S24 and S30 showed lower signals of NanoLuc and firefly luciferase signal from the (GGGGCC)70-containing reporter transcripts. The significant reduction of the NanoLuc luciferase signal relative to the firefly luciferase signal demonstrates that the repeat-associated RAN translation is inhibited by Cas13d-mediated S24 or S30 treatment. ( C ) The control cells harboring the reporter without the G4C2 repeat showed no effect of the Cas13d gRNAs on the translation of the reporters. ( D ) Immunoblot analysis of C9orf72 protein showed that the C9orf72 protein level was unaffected in HeLa RAN translation reporter cell lines stably expressing Cas13d-NT30, Cas13d-S24, and Cs13d-S30. ( E ) Transient cotransfection of CRISPR/Cas13d constructs with either the GA-frame, GP-frame, or GR-frame or the No-G4C2-repeat control construct in HEK293 cells showed that Cas13d-S24 and Cas13d-S30 significantly reduced both NanoLuc and firefly luciferase signals from the GA-, GP-, and GR-frame but not the negative No-G4C2-repeat control reporter compared with the non-targeting control Cas13d-NT30. ( F ) Immunoblot analysis of C9orf72 protein showed that the C9orf72 protein level was unaffected in HEK293 cells cotransfected with CRISPR/Cas13d and either the GA-frame, GP-frame, or GR-frame or the No-G4C2-repeat control construct. Data are presented as means ± SD of 3 or 4 biological replicates as indicated by the number of dots in each graph, and were analyzed with ordinary 1-way ANOVA with Dunnett’s multiple-comparison test. * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001.

Journal: The Journal of Clinical Investigation

Article Title: CRISPR/Cas13d targeting suppresses repeat-associated non-AUG translation of C9orf72 hexanucleotide repeat RNA

doi: 10.1172/JCI179016

Figure Lengend Snippet: ( A ) Schematic of the inducible luciferase-based C9orf72 RAN translation reporter system in HeLa Flp-In cells. ( B ) The reporter cells stably expressing Cas13d and gRNA S24 and S30 showed lower signals of NanoLuc and firefly luciferase signal from the (GGGGCC)70-containing reporter transcripts. The significant reduction of the NanoLuc luciferase signal relative to the firefly luciferase signal demonstrates that the repeat-associated RAN translation is inhibited by Cas13d-mediated S24 or S30 treatment. ( C ) The control cells harboring the reporter without the G4C2 repeat showed no effect of the Cas13d gRNAs on the translation of the reporters. ( D ) Immunoblot analysis of C9orf72 protein showed that the C9orf72 protein level was unaffected in HeLa RAN translation reporter cell lines stably expressing Cas13d-NT30, Cas13d-S24, and Cs13d-S30. ( E ) Transient cotransfection of CRISPR/Cas13d constructs with either the GA-frame, GP-frame, or GR-frame or the No-G4C2-repeat control construct in HEK293 cells showed that Cas13d-S24 and Cas13d-S30 significantly reduced both NanoLuc and firefly luciferase signals from the GA-, GP-, and GR-frame but not the negative No-G4C2-repeat control reporter compared with the non-targeting control Cas13d-NT30. ( F ) Immunoblot analysis of C9orf72 protein showed that the C9orf72 protein level was unaffected in HEK293 cells cotransfected with CRISPR/Cas13d and either the GA-frame, GP-frame, or GR-frame or the No-G4C2-repeat control construct. Data are presented as means ± SD of 3 or 4 biological replicates as indicated by the number of dots in each graph, and were analyzed with ordinary 1-way ANOVA with Dunnett’s multiple-comparison test. * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001.

Article Snippet: Cas13d coding sequence was amplified from a plasmid (Addgene, 109049) using a forward primer introducing an NdeI site (TACCACATATGATCGAAAAAAAAAAGTCCTTCGCCAA) and a reverse primer introducing a BamHI site (TTGCAGGATCCTTAGGAATTGCCGGACACCTTCTTTTTCTC).

Techniques: Luciferase, Stable Transfection, Expressing, Control, Western Blot, Cotransfection, CRISPR, Construct, Comparison

( A ) Schematic of RAN translation product detection in human iPSCs stably expressing Cas13d and gRNA via lentivirus transduction. ( B ) ELISA quantification in multiple C9-ALS patient iPSC cell lines showed significant reduction of poly-GP and poly-GA levels by Cas13d-S24 and CRISPR/S30 compared with the non-targeting control Cas13d-NT30. ( C ) Quantification of relative RNA levels of Cas13d in the C9-ALS patient iPSC cell lines showed variable Cas13d levels among lines, while in each line there were no significant differences among the S24, S30, and non-targeting NT30 groups. ( D and E ) Linear regression and correlation analyses showed a strong positive correlation between Cas13d expression level and poly-GP ( D ) and poly-GA ( E ) knockdown efficiency among C9-ALS patient iPSC lines. Pearson’s correlation coefficients and 2-tailed P value were computed. ( F ) Schematic of poly-GP and poly-GA detection in iMNs derived from human C9-ALS patient iPSCs. ( G ) ELISA quantification in iMN lines derived from multiple iPSC cell lines showed significant reduction in poly-GP and poly-GA levels by Cas13d-S24 and CRISPR/S30 compared with the non-targeting control Cas13d-NT30. ( H ) Quantification of relative RNA levels of Cas13d in the C9-ALS patient iMN lines showed variable Cas13d levels among lines, while in each line there were no significant differences among the S24, S30, and non-targeting NT30 groups. ( I and J ) Linear regression and correlation analyses showed a strong positive correlation between Cas13d expression level and poly-GP ( I ) and poly-GA ( J ) knockdown efficiency among C9-ALS patient iMN lines. Pearson’s correlation coefficients and 2-tailed P value were computed. Data are presented as means ± SD of 2–4 biological replicates as indicated by the number of dots in each graph, and were analyzed with ordinary 1-way ANOVA with Dunnett’s multiple-comparison test. * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001.

Journal: The Journal of Clinical Investigation

Article Title: CRISPR/Cas13d targeting suppresses repeat-associated non-AUG translation of C9orf72 hexanucleotide repeat RNA

doi: 10.1172/JCI179016

Figure Lengend Snippet: ( A ) Schematic of RAN translation product detection in human iPSCs stably expressing Cas13d and gRNA via lentivirus transduction. ( B ) ELISA quantification in multiple C9-ALS patient iPSC cell lines showed significant reduction of poly-GP and poly-GA levels by Cas13d-S24 and CRISPR/S30 compared with the non-targeting control Cas13d-NT30. ( C ) Quantification of relative RNA levels of Cas13d in the C9-ALS patient iPSC cell lines showed variable Cas13d levels among lines, while in each line there were no significant differences among the S24, S30, and non-targeting NT30 groups. ( D and E ) Linear regression and correlation analyses showed a strong positive correlation between Cas13d expression level and poly-GP ( D ) and poly-GA ( E ) knockdown efficiency among C9-ALS patient iPSC lines. Pearson’s correlation coefficients and 2-tailed P value were computed. ( F ) Schematic of poly-GP and poly-GA detection in iMNs derived from human C9-ALS patient iPSCs. ( G ) ELISA quantification in iMN lines derived from multiple iPSC cell lines showed significant reduction in poly-GP and poly-GA levels by Cas13d-S24 and CRISPR/S30 compared with the non-targeting control Cas13d-NT30. ( H ) Quantification of relative RNA levels of Cas13d in the C9-ALS patient iMN lines showed variable Cas13d levels among lines, while in each line there were no significant differences among the S24, S30, and non-targeting NT30 groups. ( I and J ) Linear regression and correlation analyses showed a strong positive correlation between Cas13d expression level and poly-GP ( I ) and poly-GA ( J ) knockdown efficiency among C9-ALS patient iMN lines. Pearson’s correlation coefficients and 2-tailed P value were computed. Data are presented as means ± SD of 2–4 biological replicates as indicated by the number of dots in each graph, and were analyzed with ordinary 1-way ANOVA with Dunnett’s multiple-comparison test. * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001.

Article Snippet: Cas13d coding sequence was amplified from a plasmid (Addgene, 109049) using a forward primer introducing an NdeI site (TACCACATATGATCGAAAAAAAAAAGTCCTTCGCCAA) and a reverse primer introducing a BamHI site (TTGCAGGATCCTTAGGAATTGCCGGACACCTTCTTTTTCTC).

Techniques: Stable Transfection, Expressing, Transduction, Enzyme-linked Immunosorbent Assay, CRISPR, Control, Knockdown, Derivative Assay, Comparison

( A ) Purified Cas13d showed a nearly 100% degradation efficiency of the target RNA r(NT24) with gRNA NT24 but not the other gRNAs, confirming the specificity and high cleavage activity of the Cas13d system. ( B ) The target RNA r(GGGGCC)2 was too short to be degraded by Cas13d. ( C – E ) The purified Cas13d showed partial degradation of the target RNAs r(GGGGCC)5 ( C ), r(GGGGCC)8 ( D ), and r(GGGGCC)12 ( E ) with gRNA S24 or S30 but not the other gRNAs, indicating a compromised cleavage activity of Cas13d targeting GGGGCC repeat RNAs and a trend of decreased cleavage efficiency with increased repeat lengths. ( F ) Cas13d was unable to degrade r(GGGGCC)28, demonstrating the limited activity of Cas13d to target or cleave longer GGGGCC repeat RNAs. The cleavage assay was performed in a buffer containing 0.3 μM of gRNA, 0.6 μM of Cas13d protein, and 40 ng/μL of target RNA. Data are presented as means ± SD of 3 independent experiments and were analyzed with unpaired 2-tailed Student’s t test ( A ) and ordinary 1-way ANOVA with Dunnett’s multiple-comparison test ( B – F ). * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.001.

Journal: The Journal of Clinical Investigation

Article Title: CRISPR/Cas13d targeting suppresses repeat-associated non-AUG translation of C9orf72 hexanucleotide repeat RNA

doi: 10.1172/JCI179016

Figure Lengend Snippet: ( A ) Purified Cas13d showed a nearly 100% degradation efficiency of the target RNA r(NT24) with gRNA NT24 but not the other gRNAs, confirming the specificity and high cleavage activity of the Cas13d system. ( B ) The target RNA r(GGGGCC)2 was too short to be degraded by Cas13d. ( C – E ) The purified Cas13d showed partial degradation of the target RNAs r(GGGGCC)5 ( C ), r(GGGGCC)8 ( D ), and r(GGGGCC)12 ( E ) with gRNA S24 or S30 but not the other gRNAs, indicating a compromised cleavage activity of Cas13d targeting GGGGCC repeat RNAs and a trend of decreased cleavage efficiency with increased repeat lengths. ( F ) Cas13d was unable to degrade r(GGGGCC)28, demonstrating the limited activity of Cas13d to target or cleave longer GGGGCC repeat RNAs. The cleavage assay was performed in a buffer containing 0.3 μM of gRNA, 0.6 μM of Cas13d protein, and 40 ng/μL of target RNA. Data are presented as means ± SD of 3 independent experiments and were analyzed with unpaired 2-tailed Student’s t test ( A ) and ordinary 1-way ANOVA with Dunnett’s multiple-comparison test ( B – F ). * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.001.

Article Snippet: Cas13d coding sequence was amplified from a plasmid (Addgene, 109049) using a forward primer introducing an NdeI site (TACCACATATGATCGAAAAAAAAAAGTCCTTCGCCAA) and a reverse primer introducing a BamHI site (TTGCAGGATCCTTAGGAATTGCCGGACACCTTCTTTTTCTC).

Techniques: Purification, Activity Assay, Cleavage Assay, Comparison

( A ) Schematic of poly-GP and poly-GA detection in mice treated with AAV9 expressing Cas13d and gRNA. ( B and C ) Quantification showed decreased levels of poly-GP ( B ) or poly-GA ( C ) in C9-500 BAC mice but not in the WT mice, when the mice were treated with AAV9 expressing Cas13d-S24 or Cas13d-S30, compared with those treated with control AAV9 expressing the non-targeting Cas13d-NT30. The number of dots in each group indicates the number of mice in the corresponding group. Data are presented as means ± SD and were analyzed with unpaired 1-tailed Student’s t test. * P < 0.05, **** P < 0.0001.

Journal: The Journal of Clinical Investigation

Article Title: CRISPR/Cas13d targeting suppresses repeat-associated non-AUG translation of C9orf72 hexanucleotide repeat RNA

doi: 10.1172/JCI179016

Figure Lengend Snippet: ( A ) Schematic of poly-GP and poly-GA detection in mice treated with AAV9 expressing Cas13d and gRNA. ( B and C ) Quantification showed decreased levels of poly-GP ( B ) or poly-GA ( C ) in C9-500 BAC mice but not in the WT mice, when the mice were treated with AAV9 expressing Cas13d-S24 or Cas13d-S30, compared with those treated with control AAV9 expressing the non-targeting Cas13d-NT30. The number of dots in each group indicates the number of mice in the corresponding group. Data are presented as means ± SD and were analyzed with unpaired 1-tailed Student’s t test. * P < 0.05, **** P < 0.0001.

Article Snippet: Cas13d coding sequence was amplified from a plasmid (Addgene, 109049) using a forward primer introducing an NdeI site (TACCACATATGATCGAAAAAAAAAAGTCCTTCGCCAA) and a reverse primer introducing a BamHI site (TTGCAGGATCCTTAGGAATTGCCGGACACCTTCTTTTTCTC).

Techniques: Expressing, Control

Journal: Cell Genomics

Article Title: Activation of the imprinted Prader-Willi syndrome locus by CRISPR-based epigenome editing

doi: 10.1016/j.xgen.2025.100770

Figure Lengend Snippet:

Article Snippet: The gRNA expression plasmid (Addgene #232183) for the single gRNA screens was generated by modifying Addgene #83925 to contain an optimized gRNA scaffold, an mCherry transgene in place of GFP, and a puromycin resistance gene in place of Bsr.

Techniques: DNA Methylation Assay, Sequencing, Recombinant, Plasmid Preparation, Expressing, Software

A. Experimental workflow for double-gene deletion AsCas12a CRISPR screening. B. Scatter plot of median Log2 fold-change of crRNAs associated with the indicated target gene after Cas12a-mediated co-deletion of Rosa26 control (WT) or Ripk1 (Ripk1null). Fold-change is calculated between in vitro and in vivo timepoints. Targets preferentially depleted in WT (red), Ripk1null (beige), or both (blue), or targets preferentially enriched in Ripk1null (orange) are highlighted and have a P-value < 0.05 (see Methods). Also shown are Log2 fold-change for individual crRNAs (red bars) for significant hits overlaid on the distribution for all crRNAs. C. Select targets identified in (B) projected onto a schematic of the TNF signaling pathway in Ripk1 WT (top) and Ripk1null (bottom) cancer cells. Highlighted gene targets (non-opaque) are depleted in WT or enriched in Ripk1null tumors and illustrate inferred signaling bias for each genotype. D-E. Expression and quantitation of NF-kB and MAPK pathway proteins (n=2–3) (D) and NF-kB transcriptional reporter activity (representative of 3 independent experiments) (E) in WT or Ripk1null B16 cancer cells after treatment with 100 ng/ml murine TNF. F. CASP3 cleavage after TNF stimulation of TSA WT or Ripk1null cells for the indicated times under serum-free conditions. G. In vitro dose response of TNF-mediated killing with 1 ug/ml cycloheximide for 24 hours for WT or Ripk1null B16 and TSA cells measured by normalized viability (representative of 2–3 independent experiments). P-values for time course was determined by repeated measures ANOVA. For dose response and reporter assay, a non-linear model was fitted and significance determined by comparison to a reduced model using ANOVA.

Journal: Immunity

Article Title: The Interferon-Stimulated Gene RIPK1 Regulates Cancer Cell Intrinsic and Extrinsic Resistance to Immune Checkpoint Blockade

doi: 10.1016/j.immuni.2022.03.007

Figure Lengend Snippet: A. Experimental workflow for double-gene deletion AsCas12a CRISPR screening. B. Scatter plot of median Log2 fold-change of crRNAs associated with the indicated target gene after Cas12a-mediated co-deletion of Rosa26 control (WT) or Ripk1 (Ripk1null). Fold-change is calculated between in vitro and in vivo timepoints. Targets preferentially depleted in WT (red), Ripk1null (beige), or both (blue), or targets preferentially enriched in Ripk1null (orange) are highlighted and have a P-value < 0.05 (see Methods). Also shown are Log2 fold-change for individual crRNAs (red bars) for significant hits overlaid on the distribution for all crRNAs. C. Select targets identified in (B) projected onto a schematic of the TNF signaling pathway in Ripk1 WT (top) and Ripk1null (bottom) cancer cells. Highlighted gene targets (non-opaque) are depleted in WT or enriched in Ripk1null tumors and illustrate inferred signaling bias for each genotype. D-E. Expression and quantitation of NF-kB and MAPK pathway proteins (n=2–3) (D) and NF-kB transcriptional reporter activity (representative of 3 independent experiments) (E) in WT or Ripk1null B16 cancer cells after treatment with 100 ng/ml murine TNF. F. CASP3 cleavage after TNF stimulation of TSA WT or Ripk1null cells for the indicated times under serum-free conditions. G. In vitro dose response of TNF-mediated killing with 1 ug/ml cycloheximide for 24 hours for WT or Ripk1null B16 and TSA cells measured by normalized viability (representative of 2–3 independent experiments). P-values for time course was determined by repeated measures ANOVA. For dose response and reporter assay, a non-linear model was fitted and significance determined by comparison to a reduced model using ANOVA.

Article Snippet: For double-gene deletion CRISPR screening, a dual-crRNA library was cloned into a AsCas12a crRNA expression vector pRG212 (EFS-GFP-P2A-Neo-U6-crRNA, Addgene #149722).

Techniques: CRISPR, Control, In Vitro, In Vivo, Expressing, Quantitation Assay, Activity Assay, Reporter Assay, Comparison

KEY RESOURCES TABLE

Journal: Immunity

Article Title: The Interferon-Stimulated Gene RIPK1 Regulates Cancer Cell Intrinsic and Extrinsic Resistance to Immune Checkpoint Blockade

doi: 10.1016/j.immuni.2022.03.007

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: For double-gene deletion CRISPR screening, a dual-crRNA library was cloned into a AsCas12a crRNA expression vector pRG212 (EFS-GFP-P2A-Neo-U6-crRNA, Addgene #149722).

Techniques: Control, Virus, Recombinant, Protease Inhibitor, Membrane, Lysis, Transfection, Luciferase, Cell Viability Assay, Mutagenesis, Staining, Sequencing, RNA Sequencing, Derivative Assay, Expressing, CRISPR, Plasmid Preparation, Retroviral, Scaffolding, Software

KEY RESOURCES TABLE

Journal: Immunity

Article Title: The Interferon-Stimulated Gene RIPK1 Regulates Cancer Cell Intrinsic and Extrinsic Resistance to Immune Checkpoint Blockade

doi: 10.1016/j.immuni.2022.03.007

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: For double-gene deletion CRISPR screening, a dual-crRNA library was cloned into a AsCas12a crRNA expression vector pRG212 (EFS-GFP-P2A-Neo-U6-crRNA, Addgene #149722).

Techniques: Control, Virus, Recombinant, Protease Inhibitor, Membrane, Lysis, Transfection, Luciferase, Cell Viability Assay, Mutagenesis, Staining, Sequencing, RNA Sequencing, Derivative Assay, Expressing, CRISPR, Plasmid Preparation, Retroviral, Scaffolding, Software